Amateurs are trying genetic engineering at home

[nmap]

I hesitate to mention the possibilities implied by this article. I will mention that mainstream researchers have modified rice to include vitamin A - it's called "golden rice". ( LINK (http://www.goldenrice.org/) ). But if a beneficial addition can be accomplished..... :eek:

---------------------------------------------------------------------


SAN FRANCISCO – The Apple computer was invented in a garage. Same with the Google search engine. Now, tinkerers are working at home with the basic building blocks of life itself.

Using homemade lab equipment and the wealth of scientific knowledge available online, these hobbyists are trying to create new life forms through genetic engineering — a field long dominated by Ph.D.s toiling in university and corporate laboratories.

In her San Francisco dining room lab, for example, 31-year-old computer programmer Meredith L. Patterson is trying to develop genetically altered yogurt bacteria that will glow green to signal the presence of melamine, the chemical that turned Chinese-made baby formula and pet food deadly.

"People can really work on projects for the good of humanity while learning about something they want to learn about in the process," she said.

So far, no major gene-splicing discoveries have come out anybody's kitchen or garage.

But critics of the movement worry that these amateurs could one day unleash an environmental or medical disaster. Defenders say the future Bill Gates of biotech could be developing a cure for cancer in the garage.

Many of these amateurs may have studied biology in college but have no advanced degrees and are not earning a living in the biotechnology field. Some proudly call themselves "biohackers" — innovators who push technological boundaries and put the spread of knowledge before profits.

In Cambridge, Mass., a group called DIYbio is setting up a community lab where the public could use chemicals and lab equipment, including a used freezer, scored for free off Craigslist, that drops to 80 degrees below zero, the temperature needed to keep many kinds of bacteria alive.

Co-founder Mackenzie Cowell, a 24-year-old who majored in biology in college, said amateurs will probably pursue serious work such as new vaccines and super-efficient biofuels, but they might also try, for example, to use squid genes to create tattoos that glow.

Cowell said such unfettered creativity could produce important discoveries.

"We should try to make science more sexy and more fun and more like a game," he said.

Patterson, the computer programmer, wants to insert the gene for fluorescence into yogurt bacteria, applying techniques developed in the 1970s.

She learned about genetic engineering by reading scientific papers and getting tips from online forums. She ordered jellyfish DNA for a green fluorescent protein from a biological supply company for less than $100. And she built her own lab equipment, including a gel electrophoresis chamber, or DNA analyzer, which she constructed for less than $25, versus more than $200 for a low-end off-the-shelf model.

Jim Thomas of ETC Group, a biotechnology watchdog organization, warned that synthetic organisms in the hands of amateurs could escape and cause outbreaks of incurable diseases or unpredictable environmental damage.

"Once you move to people working in their garage or other informal location, there's no safety process in place," he said.

Some also fear that terrorists might attempt do-it-yourself genetic engineering. But Patterson said: "A terrorist doesn't need to go to the DIYbio community. They can just enroll in their local community college."




LINK (http://news.yahoo.com/s/ap/20081225/ap_on_sc/do_it_yourself_dna)

[Pete]

Somebody has to do it. All the "real" scientists are out beating the Global Warming drum.

[gagners]

Much ado bout nothing. Sure, something could go wrong, but something could go wrong when someone brews beer at home or makes soap (glycerin mixed with nitric acid... you've seen fight club ;))

God forbid someone without drug company sponsorship finds a cure or vaccine for something who isn't in it for the money...:boohoo

[Conrad Y]

This is so interesting, it reminds me of the beginning of "I am legend".

Monsanto Company has been messing with GMO (Genetically Modified Organisms) agricultural engineering for a long time now giving us the benefits of Aspartame sweetener (in your chewing gum and all diet soda) that destroys your brain and nervious system. Canola oil, cotton seed, corn, soy and now sweet potatoes that are spliced with insect DNA among other crap to patent crops and ruin our bodies so that we all are on Nexium and other drugs. Move over Monsanto and let others screw up our food supply too. Monsanto and our FDA are in bed together making billions on untested products. Monsanto wants all crops patented by 2011 (that means that everyone has to buy seeds from them).

No wonder all those natural seeds were stashed under the ice in a vault in Norway this year. Protect the good seeds from cross-pollination from the GMO crops with the few bees that haven't been poisoned to death by these do-gooders. Maybe those seeds can be used by the survivors after we are all killed off. A simple Google search will show that what I say is not just hot air.

Just because they can does not mean they should.

[Box]

I recently experimented with a mixture of chocolate milk and banana milk...

[abc_123]

I recently experimented with a mixture of chocolate milk and banana milk...

Be careful with that... You know what happened to Richard Pryor!:eek:

[CPTAUSRET]

I recently experimented with a mixture of chocolate milk and banana milk...

"You could put your eye out!"

[Team Sergeant]

"Using homemade lab equipment and the wealth of scientific knowledge available online, these hobbyists are trying to create new life forms through genetic engineering — a field long dominated by Ph.D.s toiling in university and corporate laboratories."

It could be worse, these hobbists could be attempting to make more powerful drugs then "crack" or "E", or using the power of the internet to build bombs, shut down power grids or learn to destabilize governments..... ;)

[lksteve]

...or using the power of the internet to build bombs, shut down power grids or learn to destabilize governments..... Those are bad things...?;)

[anythingrandom]

This is so interesting, it reminds me of the beginning of "I am legend".

Monsanto Company has been messing with GMO (Genetically Modified Organisms) agricultural engineering for a long time now giving us the benefits of Aspartame sweetener (in your chewing gum and all diet soda) that destroys your brain and nervious system. Canola oil, cotton seed, corn, soy and now sweet potatoes that are spliced with insect DNA among other crap to patent crops and ruin our bodies so that we all are on Nexium and other drugs. Move over Monsanto and let others screw up our food supply too. Monsanto and our FDA are in bed together making billions on untested products. Monsanto wants all crops patented by 2011 (that means that everyone has to buy seeds from them).

No wonder all those natural seeds were stashed under the ice in a vault in Norway this year. Protect the good seeds from cross-pollination from the GMO crops with the few bees that haven't been poisoned to death by these do-gooders. Maybe those seeds can be used by the survivors after we are all killed off. A simple Google search will show that what I say is not just hot air.

Just because they can does not mean they should.

Sir,

Aspartame was "grandfathered in" and was approved for consumption before it was tested, and it has not been tested. The claims against that particular beastie are many and varied, and I tend to agree with them. However, the slights against GMOs cannot go unanswered. Genetic modification has been going on for centuries, since crops were domesticated. We began selecting crops that best suited our fancies, and increased their numbers and thereby their success. The next time you eat a banana or potato, remember that it is essentially a cloned food. Adding "insect DNA" does nothing to our systems. Insect DNA is the same DNA that is in everyone else, just not in the same order. The bases are the same in all DNA, from the lowest bacteria and viruses to the largest whales, trees, and the "smartest" animals of all - humans. The insect proteins produced by the plants are proteins that do not target mammalian enzymes. Furthermore, humans have been eating insects and therefore insect DNA and proteins for a very, very long time. If you have ever spread Sevin dust around your home or garden, it has likely touched the plants, and you have eaten it. That poison decimates insects while leaving you healthy - and it is the same protein that is produced by much of the GM corn. And also remember - the reason we put milk into coffees and teas is to combat and neutralize the tannins in those drinks, which are produced to kill insects. When those proteins hit your stomach, they are destroyed by the acid, but they are rather unpalatable so we allow them to bind milk proteins instead of our own. The additional plants you have mentioned are being modified to produce more and better crops. Farming practices have become more efficient as well. Remember, if you were to eat fertilizer, you would be very dead. Filtering this poison through plants allows us to turn it into usuable goodies. By increasing yields per acre, we have furthered the domination and allowed the term "bread basket" to stand in reference to the Midwest for years, and with good reason.

Consumers should be more concerned about the medications being given to farm animals, as those are targeted to mammals and can therefore interfere with our own systems. By using hormones to control the growth of cattle and prevent them from storing other competing hormones, we have altered the taste of the meat. There is evidence that these hormones are speeding up human development, causing early puberty. Also, the antibiotics used often remain in the meats. A person allergic to these could react severely. Strangely, genetic modification will easily clear up these problems. And cloned meat has been approved by the FDA.

I teach these subjects, and I have heard claims against them ranging from "it's against God" to "I know someone that died from GMOs." I have to grin and bear it, but I am lucky enough to have two threads in a week where I felt I could contribute (this one and the thread about punk rock) to what is a very educated forum audience. This subject is very difficult to approach, as only very few people are educated in its finer points. This is why our legislation lags behind the science, as I will discuss further. But these issues are just a few that contribute to the misunderstanding and maligning of a very beneficial science.

And for the record, genetically modified seed organisms are also being included in the "Doomsday Vault."

Now to the thread proper....

Absolutely terrifying. Do we allow amateurs a bit of plutonium to work on nuclear reactors? Do we license C4 for home use? No. Why should we allow something far more dangerous into the hands of home users.

Care to find a REAL WMD? Look up the genomes for the 1918 flu, smallpox, or plague. Program those into the sequencers. Tada!

Feeling creative? Add an immune system enzyme to any of the above, to act as "static" in the signaling pathways! Even more dangerous!

Want to leave your mark? Simple - ggaggaggaggaggaggagauuuuucu

My initials programmed into the tail of a protein. Come find me!

For easily less than $1000, a negative pressure biolab could be built using common materials from Home Depot. That's including engineering materials and all.

Make bombs? Turn off power grids? Destabilize the government? Waste of time. Just make a virus and kill everyone.

Again, the legislation lags behind.

[Conrad Y]

anythingrandom,

Agreeing about Aspartame (Nutrasweet) being bad and farm animal injecting with growth hormones also being bad is a start, good. I understand that civilization has been doing hybridization for eons, this is true but it's not GMO Frankenfoods. Using a gene gun and shooting into cultures hoping for the desired result then feeding it to mice and rats and when they are sterile or die quicker than normal, alter the test data to reflect a good result is not good. There are many studies on this subject that are out there. If I must I can post some links worth watching. Monsanto and the other top companies want ALL crops patented so farmers have to go to them for more seeds, very bad. Monsanto is currently using their friends at the FDA to do a lawsuit against Whole Foods.

I understand you lecture on this subject so check into the revolving door between the FDA and Monsanto along with a simple search on GMO foods linked with sterilization, low sperm count, acid reflux and a host of other problems including cross-pollinization into ajacent farm fields and the drastic loss of the worlds honey bee population.

There is enough data to suggest that GMO foods (not hybrid foods) are not properly tested, they are pushed through the testing process and rubber-stamped by the corrupt former Monsanto employees in the FDA and are possibly life threatening for the worlds population. If the FDA and other watchdog groups spent half as much time looking at these GMO testing data procedures as they do going after natural food farmers and places like Whole Foods we would not have ANY of these being forced on us.

A simple thing would be if the FDA required all GMO foods and ingredients to be labled as such and let the consumers decide. I sure don't want my family to eat that crap.

If big companies are making Frankenfoods now imagine the potential after garage biologists start in on it too.

[Conrad Y]

Just to lighten it up.

[anythingrandom]

Sir,

Agreed that Monsanto corruption runs rampant within our government testing agencies. My biotech professor actually excused herself from the company for those reasons. However, I stick to my claim that the science itself is beneficial, if regulated properly. The sperm count has been decreasing for decades, and it is likely that much of the adverse effects due to food consumption are from the chemicals we spray on/around the crops. Also, gene transfer from these crops has been seen up to 100 miles away, and pockets of resistance are popping up everywhere, both in plants and insects. These crops are inventions, and the patenting of them is expected. By engineering the plants to be self-terminating, the spread of genes outside the population is limited. However, a side-effect (that helps keep these companies in the black) is that Joe Farmer has to purchase seeds every year.

I hope that in the next decades that the science of GMO production itself will become trusted. To do that, we will need to overhaul the testing agencies. Also, far better methods are being developed to tweak the plants' expression patterns. Hopefully we will no longer be using the gene gun. Companies like Dow Agrosci are really pushing a lot of the newer techniques, and they will become industry standard pretty soon. The corrupting influence of the dollar is partly to blame for the scientists performance. I myself would never fudge results. It is bad science, and can have nasty consequences.

Agreed, as well, on the topic of allowing technologies into the hands of amateurs. Good intentions can end badly. And they will. Let's not speak further of those with bad intentions.

And...always cut your apples first. Make sure they're dead.

Good talk, sir.

[nmap]

Anythingrandom, I was wondering if there have been any large scale longitudinal studies, using human subjects, published regarding the impact of GMOs on health. You mention money, and I recognize such studies are expensive; however, if we don't have such results how can we really say with any confidence that GMOs have no impact - adverse or otherwise - on humans?

[anythingrandom]

nmap,

I have seen your question and will begin researching. I'll try to compile all that I have already on the FDA/EPA testing procedures as well, and concoct one flow chart with mulitple references for each step. Might take a few days.

ATR

[Pete]

....., using human subjects, published regarding the impact of GMOs on health........

Is it safe to eat? That is the question.

Safe short term or safe long term? Another question.

Grilling meat is unsafe, some say, to your long term health.

A mule is a genetic mix of two animals but safe to eat. Selective breeding and cross breeding have both been used for a long time. Grafting and splicing have also been used for a long time.

I have a pretty simple take on things, you can eat just about anything - even dirt. Most of the stuff that will do you harm, like Polar Bear Liver, will overload your system with something that is toxic to your system. Heck, we even know why onions make you cry. Love to eat them - but making acid on your eyeballs? Now that sounds bad.

I'm sure if they mix corn with a toxic frog from SA they'll find out the cemical makeup of the corn before they put it on the store shelf.

[nmap]

nmap,

I have seen your question and will begin researching. I'll try to compile all that I have already on the FDA/EPA testing procedures as well, and concoct one flow chart with mulitple references for each step. Might take a few days.

ATR


Thank you very much; it sounds as if you will be doing quite a lot of work on my behalf, and I appreciate it.

[anythingrandom]

As a nerd/masochist, I'm looking forward to the burn!

[nmap]

Is it safe to eat? That is the question.

Safe short term or safe long term? Another question.

Grilling meat is unsafe, some say, to your long term health.



True, and all good points.

My question was driven by the estrogen replacement therapy problems of some years ago. In that case, an FDA approved treatment - one widely recommended to millions of women by their doctors - proved to have severe and adverse side effects.

I am confident that the companies will not knowingly or intentionally put bad things on the shelves. I am less sure how far they will go to test the products they produce. However, Anythingrandom's information should go a long way toward answering that.

Since I had bacon this morning, I probably don't have any right to concern myself with GMO effects.... ;)

[Conrad Y]

I think some outside links to look at are in order. I thought that at one time the best interest for the world food chain is GMO, I thought wrong and am now convinced that organic is best.

http://www.responsibletechnology.org/GMFree/Home/index.cfm

http://www.youtube.com/watch?v=swVjzIVqRUA

http://www.livevideo.com/video/embedLink/1C4FB64D50354B9A856504954B453CC9/580798/the-world-according-to-monsant.aspx

http://www.independent.co.uk/environment/gm-new-study-shows-unborn-babies-could-be-harmed-522109.html

http://www.regnum.ru/english/526651.html

Many whistle-blowers have been canned for showing that GMO foods are scary.

This took me a few minutes to just get this small amount if info on the subject.
Austrian, Italian, UK and EU studies have been in the works for some time. The EU learned a BIG lession with the effects of Mad Cow so they are actually researching a little better than the FDA's rubber-stamp approach here in the US.
The UK saw a 50% increase in soy allergy after the introduction of GMO soy products into the food supply of the country.

Our ever-watchful FDA waived the four-phase testing protocals for all GMO products (they said it was too difficult to analyse the test data so it was just better to feed it to our kids instead).

Canada last year started a testing program but dropped it. Too difficult.

One study done on soy showed that the human subjects were actually producing pesticide enzymes (BT) in their DNA along the digestive tract long after the test concluded.

This stuff (GMO foods) is at least worth stopping until real testing proticals can be aggreed upon. Any other product can be recalled if it is found to be dangerous but this cannot.

Food for thought. Bad pun.

[hunteran]

One study done on soy showed that the human subjects were actually producing pesticide enzymes (BT) in their DNA along the digestive tract long after the test concluded.


I'm not sure that I buy that entirely. Do you have a link to the study? I could see the BT toxin persisting in the digestive tract, but I don't really see how humans could produce the stuff themselves. That would require cells to both take up the Cry9C gene and express it. I'm don't claim to be an expert, but given what I DO know I don't see that as very likely.

Just a little background on BT toxin (we studied it in my molecular and cellular biology class this past semester)

BT toxin is a naturally occurring toxin (normally found in Bacillus thuringiensis, a soil bacteria) that is harmful to the larvae of moths (the protein binds to the gut lining of larvae and causes the intestinal wall to leak which allows gut bacteria to invade the rest of the body and causes death from septicaemia) and hasn't been shown to cause any adverse reaction in fish, mammals, birds or even other types of insects. Inserting the BT toxin producing gene into corn, tobacco and other crops allows the crops to produce the BT toxin for themselves and thus protect themselves against pests. The EPA didn't approve the stuff for human consumption because the proprietary genetically modified toxin is more heat stable and doesn't break down as quickly. There haven't been any proven links between the BT toxin and adverse reactions in people.

[The Reaper]

Tinfoil hats, anyone?

TR

[Conrad Y]

Try reading this stuff, if it helps.

http://www.i-sis.org.uk/banGMOsNow.php

http://www.seedsofdeception.com/Public/Home/index.cfm

http://blog.wired.com/wiredscience/2008/06/video-how-to-us.html

[hunteran]

Try reading this stuff, if it helps.

http://www.i-sis.org.uk/banGMOsNow.php

http://www.seedsofdeception.com/Public/Home/index.cfm

http://blog.wired.com/wiredscience/2008/06/video-how-to-us.html


Thanks for the articles, I will have to read those over when I have some free time.

[cold1]

Absolutely terrifying. Do we allow amateurs a bit of plutonium to work on nuclear reactors? Do we license C4 for home use? No. Why should we allow something far more dangerous into the hands of home users.

Care to find a REAL WMD? Look up the genomes for the 1918 flu, smallpox, or plague. Program those into the sequencers. Tada!

Feeling creative? Add an immune system enzyme to any of the above, to act as "static" in the signaling pathways! Even more dangerous!

Want to leave your mark? Simple - ggaggaggaggaggaggagauuuuucu

My initials programmed into the tail of a protein. Come find me!

For easily less than $1000, a negative pressure biolab could be built using common materials from Home Depot. That's including engineering materials and all.

Make bombs? Turn off power grids? Destabilize the government? Waste of time. Just make a virus and kill everyone.

Again, the legislation lags behind.

I have to argue with you here. Lets look at some of the better amateurs, Tesla, Edison, and my favorite Einstien. I am all for regulating WMD but I dont want our amatuer inventors and expeirmenters hobbled by the government. Some of the best and greatest discoveries have come from NON PhDs. And what about the time before there were Doctorate degrees. People still invented and discovered things. Why is it important not to shakle our amateur base? Because these people have a passion, they might not have taken the 8-15 years out of their life to pursue a doctorate degree, but they are still out there on their own time and their own dime trying to make something work. Unlike most with a Doctorate in health sciences who are just out to use their status to gain employement.

And to add to the list
Bill Gates
Alfred Nobel